Mapping the world's entheogenic genomes.

Open reference genomes to support the taxonomy, conservation and study of entheogenic organisms.

The gap

Establishing reference barcodes across entheogenic taxa.

Entheogenic organisms (psilocybin-producing fungi, mescaline-bearing cacti, tryptamine-rich plants) comprise hundreds of species across dozens of genera, on every continent. Taxonomy, conservation status and evolutionary history remain provisional where the molecular record is absent.

Fungal genera are our first focus: Psilocybe,Panaeolus, Gymnopilus, Pluteus,Inocybe, Conocybe. They remain phylogenetically unresolved, with little population-level genetic data for taxa of conservation concern. The same absence holds for mescaline-bearing cacti and the major tryptamine plants. Baseline sequences support IUCN assessment and evolutionary inference across these taxa.

Scanning electron micrograph of Psilocybe aztecorum spores at 6,600× magnification — Fig. 1P. aztecorum: scanning electron micrograph of the spore surface, 6,600×.

Program 1 · Psilocybe

Genome coverage across Psilocybe.

Psilocybe is our first genome-scale program. Relative to other entheogenic taxa it is the most heavily sequenced genus, and still fewer than one in ten accepted species has a published assembly. For most, no molecular record exists at all.

Alongside the tryptamines (psilocybin, baeocystin, norbaeocystin and norpsilocin), the genus produces harmane, harmine and other β-carbolines: monoamine oxidase A inhibitors drawn from the same tryptophan pool, acting on the enzyme that degrades psilocin.

The psilocybin biosynthetic cluster occurs in two gene orders across the deepest divergence in the genus, and has entered unrelated lineages repeatedly since the Eocene. Questions of origin and transfer, and an alkaloid repertoire still largely unsurveyed, require dense genomic sampling across the clade.

7 lineages shown · coverage drawn from NCBI GenBank, July 2026151 of the ~165 accepted Psilocybe species have no published genome assembly

DNA barcoding

Multi-locus barcodes and whole-genome assemblies, openly deposited.

For vouchered specimens entering the program, we produce multi-locus barcodes (standardized markers such as ITS and LSU) and, where material and funding allow, whole-genome assemblies. Each record is linked to a herbarium accession, geographic coordinates and collection provenance.

Fieldwork proceeds under Nagoya-compliant access agreements, prior informed consent and equitable benefit-sharing with source communities.

All data is deposited in GenBank under open access.

An Oxford Nanopore MinION sequencer mounted on stands with its flow-cell bay open and its USB cable arcing overhead — Fig. 2Oxford Nanopore MinION used for long-read sequencing in the field and lab.

Below: a schematic nanopore current trace basecalled to the conserved ITS1 opening used in fungal barcoding; illustrative, not deposited data.

Schematic · nanopore current traceITS · 5′ → 3′

ITS…TCCGTAGGTGAACCTGCGGAAGGATCATTA…Psilocybe zapotecorum

Evidence

Open depositions, pipeline and publications.

Category	ID	Title	Authors	Source
BioProject	PRJNA1013220	Entheome Foundation genome sequencing	Entheome Foundation	GenBank · 6 assemblies
Pipeline	EGAP	Entheome Genome Assembly Pipeline	I. M. Bollinger	GitHub · Bioconda
Publication	2025	High-quality draft genomes of ecologically and geographically diverse Psilocybe species	Bollinger et al.	Microbiol Resour Announc
Publication	2024	Cultivation, chemistry, and genome of Psilocybe zapotecorum	Miller et al.	J. Psychedelic Studies

Expeditions

Field collection and on-site sequencing.

We collect vouchered specimens and sequence on site in regions of high endemism, focusing on taxa with no public sequence data. Completed records are returned to the communities and institutions that enabled the work.

A stream falling through dense cloud-forest vegetation in the Sierra Sur — Fig. 3Neotropical cloud forest: habitat for P. zapotecorum and allied taxa, Sierra Sur.

Researchers examining a freshly collected specimen on the forest floor — Fig. 4Vouchered collection with local researchers at approximately 2,400 m.

Psilocybe cyanescens fruiting among moss and forest litter — Fig. 5Temperate lignicolous Psilocybe: Pacific coastal woodlands and wood-chip beds.

Completed

La Martinica, Veracruz

P. zapotecorum collected near Xalapa: cultivation, chemistry and a genome assembly deposited under BioProject PRJNA1013220.

Completed

Pacific coastal woodlands

Wild-collected P. allenii and P. azurescens from California coastal and Bay Area sites; hybrid assemblies released openly with the 2025 genome announcement.

Ongoing

Station 1 · modular field lab

Our first modular field station: on-site extraction and sequencing capacity for denser sampling across undersampled Psilocybe lineages.

Support

Sustained support for open genomic deposition.

Individual giving

Recurring support for field collection, sequencing, assembly and open deposition in GenBank.

Give on Patreon

Institutional sponsorship

Companies, foundations and laboratories can sponsor expeditions, genome sequencing and open deposition.

Contact sponsorship

Collaborate

We partner with laboratories, herbaria and field researchers on joint collection, shared SOPs, co-authored depositions and coordinated pipelines across target genera.

Contact the foundation