Mapping the world's entheogenic genomes.

Open reference genomes to support the taxonomy, conservation and study of entheogenic organisms.

The gap

Establishing reference barcodes across entheogenic taxa.

Entheogenic organisms (psilocybin-producing fungi, mescaline-bearing cacti, tryptamine-rich plants) span hundreds of species across dozens of genera. Most lack a public molecular reference.

Our first focus is fungal (Psilocybe, Panaeolus,Gymnopilus, Pluteus, Inocybe,Conocybe), with mescaline-bearing cacti and the major tryptamine plants to follow. Across all of them, reference sequences enable taxonomic resolution, conservation assessment and evolutionary inference.

Scanning electron micrograph of Psilocybe aztecorum spores at 6,600× magnification
Fig. 1P. aztecorum: scanning electron micrograph of the spore surface, 6,600×.

Program 1 · Psilocybin-producing fungi

Beyond the molecule.

In 1957, an account of Mazatec mushroom ceremony in the highlands of Oaxaca entered the American popular press, and within a decade psilocybin had become one of the most culturally consequential molecules of the twentieth century. It passed through Sandoz Laboratories, through the counterculture, through decades of prohibition, and eventually into the architecture of a new clinical discipline. By the time serious research resumed, the molecule was among the most discussed in all of pharmacology. The fungi that produce it remained, in most meaningful respects, unstudied.

This is a peculiar situation, as these organisms do not produce psilocybin alone. By way of a four-enzyme cluster, they turn tryptophan into psilocybin and its dephosphorylated tryptamine relatives: baeocystin, norbaeocystin, norpsilocin. Then, by an entirely separate biosynthetic route, they use that same amino acid to produce β-carbolines that reversibly inhibit monoamine oxidase A — the enzyme primarily responsible for degrading psilocin in the body. In other words, both the prodrug and a chemical brake on its metabolism, inside a single organism.

The genetics only make this more fascinating. The biosynthetic cluster that builds psilocybin is roughly sixty-seven million years old, arising near the Cretaceous–Paleogene boundary. It exists today in at least two distinct gene-order architectures, corresponding to the deepest phylogenetic split withinPsilocybe, which suggests the pathway may have been acquired more than once. More remarkably still, the entire cluster has jumped into unrelated mushroom lineages on at least four occasions since the Eocene.

And yet of the roughly one hundred and sixty-five accepted species in the genus, fewer than fifteen have a published genome assembly. For most of the wider group of psilocybin-producing fungi, the public molecular record is a single ITS barcode — or nothing at all. Neither the origin of this pathway nor its movement across forty million years of fungal evolution can be reconstructed without genomes. Our program's mission is to build the most comprehensive map of psilocybin-producing organisms: vouchered collection, multi-locus barcoding, whole-genome sequencing, and open deposition.

P. zapotecorumOaxaca · MXP. mulierculaCentral MXP. cubensisPantropicalP. subaeruginosaAUP. cyanescensTemperateP. semilanceataHolarcticP. mexicanaHighland MX14of ~165Genome assemblies

7 lineages shown · coverage drawn from NCBI GenBank, July 2026151 of the ~165 accepted Psilocybe species have no published genome assembly

DNA barcoding

Multi-locus barcodes and whole-genome assemblies, openly deposited.

For vouchered specimens entering the program, we produce multi-locus barcodes (standardized markers such as ITS and LSU) and, where material and funding allow, whole-genome assemblies. Each record is linked to a herbarium accession, geographic coordinates and collection provenance.

Fieldwork proceeds under Nagoya-compliant access agreements, prior informed consent and equitable benefit-sharing with source communities.

All data is deposited in GenBank under open access.

An Oxford Nanopore MinION sequencer mounted on stands with its flow-cell bay open and its USB cable arcing overhead
Fig. 2Oxford Nanopore MinION used for long-read sequencing in the field and lab.

Below: a schematic nanopore current trace basecalled to the conserved ITS1 opening used in fungal barcoding; illustrative, not deposited data.

Schematic · nanopore current traceITS · 5′ → 3′
TCCGTAGGTGAACCTGCGGAAGGATCATTA

ITS…TCCGTAGGTGAACCTGCGGAAGGATCATTA…Psilocybe zapotecorum

Evidence

Open depositions, pipeline and publications.

CategoryIDTitleAuthorsSource
BioProjectPRJNA1013220Entheome Foundation genome sequencingEntheome FoundationGenBank · 6 assemblies
PipelineEGAPEntheome Genome Assembly PipelineI. M. BollingerGitHub · Bioconda
Publication2025High-quality draft genomes of ecologically and geographically diverse Psilocybe speciesBollinger et al.Microbiol Resour Announc
Publication2024Cultivation, chemistry, and genome of Psilocybe zapotecorumMiller et al.J. Psychedelic Studies

Expeditions

Field collection and on-site sequencing.

We collect vouchered specimens and sequence on site in regions of high endemism, focusing on taxa with no public sequence data. Completed records are returned to the communities and institutions that enabled the work.

A stream falling through dense cloud-forest vegetation in the Sierra Sur
Fig. 3Neotropical cloud forest: habitat for P. zapotecorum and allied taxa, Sierra Sur.
Researchers examining a freshly collected specimen on the forest floor
Fig. 4Vouchered collection with local researchers at approximately 2,400 m.
Psilocybe cyanescens fruiting among moss and forest litter
Fig. 5Temperate lignicolous Psilocybe: Pacific coastal woodlands and wood-chip beds.
Completed

La Martinica, Veracruz

P. zapotecorum collected near Xalapa: cultivation, chemistry and a genome assembly deposited under BioProject PRJNA1013220.

Completed

Pacific coastal woodlands

Wild-collected P. allenii and P. azurescens from California coastal and Bay Area sites; hybrid assemblies released openly with the 2025 genome announcement.

Ongoing

Station 1 · modular field lab

Our first modular field station: on-site extraction and sequencing capacity for denser sampling across undersampled Psilocybe lineages.

People

The board.

Board of Directors

Portrait of Ian M. Bollinger

Ian M. Bollinger

Multi-Disciplinary Natural Philosopher · Bioinformaticist

Ian M. Bollinger is a founding board member and bioinformaticist at the Entheome Foundation and the developer of EGAP, the open-source genome assembly pipeline behind the Entheogen Genome Project. An analytical chemist and geneticist, he has first-authored and co-authored published Psilocybe genomes and co-founded Hyphae Labs.

Portrait of Caine Barlow

Caine Barlow

Mycologist · Ethnobotanist · Bioinformaticist

Caine Barlow is a mycologist, fungi educator, and co-founder of the Entheome Foundation, based in Melbourne, Australia. He holds a Master of Science in bioinformatics and conservation mycology from the University of Melbourne, has co-authored work on Psilocybe ecology and genetics, and has supported Entheogenesis Australis publications and education programs for several years.

Portrait of Harte Singer

Harte Singer

Mycologist · Molecular Biologist · Bioinformaticist

Harte Singer is a mycologist and board member of the Entheome Foundation, co-author on published Psilocybe genomes including P. zapotecorum. Trained in cell and molecular biology, he came to the field through foraging and community science at Counter Culture Labs and through his business Dikarya LLC, and has taught community mycology workshops.

Portrait of Alan Rockefeller

Alan Rockefeller

Mycologist · Photographer · Bioinformaticist

Alan Rockefeller is a mycologist and board member of the Entheome Foundation, specializing in fungal taxonomy, DNA barcoding, microscopy, and field photography. He co-described Psilocybe allenii, has documented thousands of fungal species across the Americas, and teaches molecular methods at Counter Culture Labs in Oakland.

Board Emeritus

Portrait of Jason C. Slot, PhD

Jason C. Slot, PhD

Evolutionary Biologist · Proffessor · Scientific Advisor

Jason C. Slot, PhD, is a founding member and scientific advisor to the Entheome Foundation and a professor of fungal evolutionary genomics at The Ohio State University. His laboratory studies fungal metabolic gene clusters, including the evolution of the psilocybin biosynthetic cluster.

Support

Sustained support for open genomic deposition.

Individual giving

Recurring support for field collection, sequencing, assembly and open deposition in GenBank.

Give on Patreon

Institutional sponsorship

Companies, foundations and laboratories can sponsor expeditions, genome sequencing and open deposition.

Contact sponsorship

Collaborate

We partner with laboratories, herbaria and field researchers on joint collection, shared SOPs, co-authored depositions and coordinated pipelines across target genera.

Contact the foundation