Mapping the world's entheogenic genomes.

Open reference genomes to support the taxonomy, conservation and study of entheogenic organisms.

The gap

Establishing reference barcodes across entheogenic taxa.

Entheogenic organisms (psilocybin-producing fungi, mescaline-bearing cacti, tryptamine-rich plants) span hundreds of species across dozens of genera. Most lack a public molecular reference.

Our first focus is fungal (Psilocybe, Panaeolus,Gymnopilus, Pluteus, Inocybe,Conocybe), with mescaline-bearing cacti and the major tryptamine plants to follow. Across all of them, reference sequences enable taxonomic resolution, conservation assessment and evolutionary inference.

Scanning electron micrograph of Psilocybe aztecorum spores at 6,600× magnification
Fig. 1P. aztecorum: scanning electron micrograph of the spore surface, 6,600×.

Program 1 · Psilocybin-producing fungi

Beyond the molecule.

Long before they carried a Latin name, some of these mushrooms were gathered in the highlands of Oaxaca and used in Mazatec ceremony. In the mid-twentieth century that knowledge entered print, then the counterculture of the 1960s, and from there a lasting current in art, music and inward life. Half a century later, the same chemistry sits at the center of the psychedelic renaissance: clinical research, new institutions, a public argument about mind and medicine. The molecule became famous. The organisms that make it did not.

What they make is more than one compound. From tryptophan they produce psilocybin and related tryptamines (baeocystin, norbaeocystin, norpsilocin) and, by a separate route from the same pool, β-carbolines that inhibit monoamine oxidase A, the enzyme that degrades psilocin: the active compounds and a brake on their breakdown, inside one organism. Their habitats range from wood and dung to grassland and cloud forest; their secondary chemistry interests both therapeutics and environmental science. For fungi this culturally charged, the biochemistry is still only partly known.

That chemistry has a deep evolutionary life. The genes for psilocybin sit in a cluster that appears in more than one architecture across the deepest splits in these lineages, and has entered unrelated mushrooms repeatedly since the Eocene.Psilocybe, the most heavily sequenced genus among them, still has a published assembly for fewer than one in ten accepted species. Across the wider family, most taxa have none.

Origin, transfer and this alkaloid repertoire cannot be resolved until the family is mapped at genome scale.

P. zapotecorumOaxaca · MXP. mulierculaCentral MXP. cubensisPantropicalP. subaeruginosaAUP. cyanescensTemperateP. semilanceataHolarcticP. mexicanaHighland MX14of ~165Genome assemblies

7 lineages shown · coverage drawn from NCBI GenBank, July 2026151 of the ~165 accepted Psilocybe species have no published genome assembly

DNA barcoding

Multi-locus barcodes and whole-genome assemblies, openly deposited.

For vouchered specimens entering the program, we produce multi-locus barcodes (standardized markers such as ITS and LSU) and, where material and funding allow, whole-genome assemblies. Each record is linked to a herbarium accession, geographic coordinates and collection provenance.

Fieldwork proceeds under Nagoya-compliant access agreements, prior informed consent and equitable benefit-sharing with source communities.

All data is deposited in GenBank under open access.

An Oxford Nanopore MinION sequencer mounted on stands with its flow-cell bay open and its USB cable arcing overhead
Fig. 2Oxford Nanopore MinION used for long-read sequencing in the field and lab.

Below: a schematic nanopore current trace basecalled to the conserved ITS1 opening used in fungal barcoding; illustrative, not deposited data.

Schematic · nanopore current traceITS · 5′ → 3′
TCCGTAGGTGAACCTGCGGAAGGATCATTA

ITS…TCCGTAGGTGAACCTGCGGAAGGATCATTA…Psilocybe zapotecorum

Evidence

Open depositions, pipeline and publications.

CategoryIDTitleAuthorsSource
BioProjectPRJNA1013220Entheome Foundation genome sequencingEntheome FoundationGenBank · 6 assemblies
PipelineEGAPEntheome Genome Assembly PipelineI. M. BollingerGitHub · Bioconda
Publication2025High-quality draft genomes of ecologically and geographically diverse Psilocybe speciesBollinger et al.Microbiol Resour Announc
Publication2024Cultivation, chemistry, and genome of Psilocybe zapotecorumMiller et al.J. Psychedelic Studies

Expeditions

Field collection and on-site sequencing.

We collect vouchered specimens and sequence on site in regions of high endemism, focusing on taxa with no public sequence data. Completed records are returned to the communities and institutions that enabled the work.

A stream falling through dense cloud-forest vegetation in the Sierra Sur
Fig. 3Neotropical cloud forest: habitat for P. zapotecorum and allied taxa, Sierra Sur.
Researchers examining a freshly collected specimen on the forest floor
Fig. 4Vouchered collection with local researchers at approximately 2,400 m.
Psilocybe cyanescens fruiting among moss and forest litter
Fig. 5Temperate lignicolous Psilocybe: Pacific coastal woodlands and wood-chip beds.
Completed

La Martinica, Veracruz

P. zapotecorum collected near Xalapa: cultivation, chemistry and a genome assembly deposited under BioProject PRJNA1013220.

Completed

Pacific coastal woodlands

Wild-collected P. allenii and P. azurescens from California coastal and Bay Area sites; hybrid assemblies released openly with the 2025 genome announcement.

Ongoing

Station 1 · modular field lab

Our first modular field station: on-site extraction and sequencing capacity for denser sampling across undersampled Psilocybe lineages.

Support

Sustained support for open genomic deposition.

Individual giving

Recurring support for field collection, sequencing, assembly and open deposition in GenBank.

Give on Patreon

Institutional sponsorship

Companies, foundations and laboratories can sponsor expeditions, genome sequencing and open deposition.

Contact sponsorship

Collaborate

We partner with laboratories, herbaria and field researchers on joint collection, shared SOPs, co-authored depositions and coordinated pipelines across target genera.

Contact the foundation